Subacute Necrotizing Encephalopathy (Yorkshire Terrier Type)

Other Names: juvenile-onset necrotizing encephalopathy, Leigh-Like Subacute Necrotizing Encephalopathy, SNE
Affected Genes: SLC19A3
Inheritance: Autosomal Recessive
Mutation: chr25:40615750-40615755 (canFam4): CACGGG/GCAGCAGCACCAGATAAGACATAGTCAGTGAGGAT
Breed(s): Yorkiepoo, Yorkshire Terrier

Add To Cart Search Tests

Common Symptoms

Subacute Necrotizing Encephalopathy (Yorkshire Terrier Type) is an inherited neurological disease affecting dogs. Affected dogs are unable to produce a protein important in transporting the essential nutrient, thiamine (vitamin B1) into cells of the body and typically present with neurological symptoms before 1 year of age. Cells of the nervous system are particularly dependent upon thiamine for the nutrient’s role in energy metabolism. As seen in this disorder, severe thiamine deficiency leads to death of neurons in the brain and subsequent neurological disease. Symptoms include weakness in limbs, altered mental state, loss of balance, abnormal gait, and blindness. The disease is progressive and affected dogs are typically euthanized due to poor quality of life within several months of initial clinical presentation.

Testing Tips

Genetic testing of the SLC19A3 gene will reliably determine whether a dog is a genetic Carrier of Subacute Necrotizing Encephalopathy (Yorkshire Terrier Type). This disease is inherited in an Autosomal Recessive manner in dogs meaning that they must receive two copies of the mutated gene (one from each parent) to develop the disease. In general, carrier dogs do not have features of the disease but when bred with another carrier of the same Mutation, there is a risk of having affected pups. Each pup that is born to this pairing has a 25% chance of inheriting the disease and a 50% chance of inheriting one copy and being a carrier of the SLC19A3 gene mutation. Reliable genetic testing is important for determining breeding practices. In order to eliminate this mutation from breeding lines and to avoid the potential of producing affected pups, breeding of known carriers to each other is not recommended. Dogs that are not carriers of the mutation have no increased risk of having affected pups.

There may be other causes of this condition in dogs and a normal result does not exclude a different mutation in this gene or any other gene that may result in a similar genetic disease or trait.

References

  • Baiker K, Hofmann S, Fischer A, Gödde T, Medl S, Schmahl W, Bauer MF, Matiasek K. Leigh-like subacute necrotising encephalopathy in Yorkshire Terriers: neuropathological characterisation, respiratory chain activities and mitochondrial DNA. Acta Neuropathol. 2009 Nov;118(5):697-709 [PubMed: 19466433]
  • Drögemüller M, Letko A, Matiasek K, Jagannathan V, Corlazzoli D, Rosati M, Jurina K, Medl S, Gödde T, Rupp S, Fischer A, Luján Feliu-Pascual A, Drögemüller C. SLC19A3 Loss-of-Function Variant in Yorkshire Terriers with Leigh-Like Subacute Necrotizing Encephalopathy. Genes (Basel). 2020 Oct 16;11(10):1215. [PubMed: 33081289]